It's now this, suckers: health freedom fm poison vaxxes vs. virtue-signaling, hysteria, & tyranny

[Apollonian]

Study: COVID-19 vaccines increase risk of heart attack by 127%​

Link: https://www.cracknewz.com/2021/12/study-covid-19-vaccines-increase-risk.html

---

A new study published by the American Heart Association (AHA) found that Wuhan coronavirus (COVID-19) vaccines increase a person’s risk of experiencing a heart attack by as much as 127 percent.
The AHA is one of the leading nonprofit organizations in the United States that funds medical research into cardiovascular health.
The researchers who conducted the study looked at the changes in PULS scores of people who had been monitored every three to six months for the past few years. The PULS test, or Protein Unstable Lesion Signature test, measures the protein biomarkers in the body that indicate if the immune system has recently responded to arterial injuries such as reduced blood flow, myocarditis, pericarditis and heart attacks.
The study was conducted on a group of 500 patients who were vaccinated with the mRNA vaccines. It found higher counts of blood markers, suggesting that the patients were experiencing heart complications.
The study further found that these risk increases continued to be present 2.5 months after the patients received the second dose of the mRNA COVID-19 vaccines.
The tests indicated that the five-year risk of a heart attack or other heart complication among the patients more than doubled from 11 percent to 25 percent. This represents a 127 percent increase in the risk of suffering a heart attack within five years after getting vaccinated.
This is not the only study to have observed a connection between the mRNA COVID-19 vaccines and heart complications.
In Sweden, Iceland, Finland and Denmark, Moderna’s COVID-19 vaccine was halted for distribution for people under 30 because of the high prevalence of heart complications among those who received this vaccine.
In Taiwan, young adults and eligible teenagers were prevented from receiving the second dose of Pfizer’s COVID-19 vaccine due to similar heart complications. The country found that the chances of being hospitalized for COVID-19 are significantly less than being hospitalized for heart complications caused by the Pfizer vaccine.

Study could explain thousands of “non-COVID deaths” due to heart attacks​

Dr. Aseem Malhotra, a cardiologist working in the United Kingdom, pointed out that there have been around 10,000 excess deaths recorded in the country. These deaths are supposedly not related to COVID-19, but many of them are due to heart attacks and strokes.
Malhotra said that if the mRNA COVID-19 vaccine is increasing the risk of heart attacks, then this would explain at least some of the excess deaths.
Malhotra’s suspicions were confirmed when a medical researcher whistleblower contacted him to say that imaging studies proved that the vaccines cause inflammation in the coronary arteries.
This whistleblower mentioned that they do not want to publish the results of the study yet because of fears of backlash from the medical community and the potential to lose opportunities to obtain grant money for future studies from the pharmaceutical industry.
The cardiologist also cited another study that used a test similar to the one conducted by the AHA researchers to predict the risk of heart attacks in their patients. This study found that the mRNA COVID-19 vaccines “dramatically increase inflammation on the endothelium and T cell infiltration of cardiac muscle.” The study suggests that the mRNA vaccines “may account for the observations of increased thrombosis, cardiomyopathy and other vascular events following vaccination.”
Malhotra have also heard multiple testimonials from healthcare workers in the U.K., saying that they have seen a surge in heart attacks – especially among younger people.
The overwhelming amount of data proves that more and more younger adults in the U.K. are coming down with blood clots, myocarditis and other heart complications after getting vaccinated for COVID-19.
In the U.S., the Centers for Disease Control and Prevention is maintaining that the vaccines are safe, effective and essential in stopping the spread of COVID-19 despite the overwhelming evidence that the mRNA COVID-19 vaccines are not protecting people and are actually aiding in their premature deaths.

 

[Apollonian]

Judge rules on US Navy SEALs vaccination dispute​

by RT
January 4th 2022, 5:16 am

Link: https://www.infowars.com/posts/judge-rules-on-us-navy-seals-vaccination-dispute/

US judge rules in favor of Navy SEALs refusing vaccination on religious grounds

A Texas court ruled that it would be unconstitutional for the US Navy to punish service members seeking a religious exemption from President Joe Biden’s vaccine mandate.

District Judge Reed O’Connor issued a preliminary order on Monday blocking the Navy and the Department of Defense from enforcing their vaccine rules.


“The Navy service members in this case seek to vindicate the very freedoms they have sacrificed so much to protect,” the judge wrote in his decision. “The Covid-19 pandemic provides the government no license to abrogate those freedoms. There is no Covid-19 exception to the First Amendment. There is no military exclusion from our Constitution.”

The judge was acting on a lawsuit filed by 35 service members, including SEALs and Navy crewmen and divers, who wanted to refuse the vaccine on religious grounds. According to court documents, the plaintiffs are Catholic, Eastern Orthodox Christians, and Protestants.

The plaintiffs faced disqualification for refusing, which would make them “permanently non-deployable,” the judge wrote.

Dr. Robert Malone’s assertions about “mass formation psychosis” in the context of the COVID-19 pandemic are underscored by the fact that authorities in the UK admitted to using “totalitarian” methods of “mind control” to instill fear in the population. Read more: https://www.infowars.com/posts/mass...by-governments-as-tool-of-population-control/

The judge noted that 99.4% of active-duty Navy service member had been fully vaccinated against Covid-19 by early November.


First Liberty Institute, a legal organization representing the plaintiffs, welcomed the order. “Punishing SEALs for simply asking for a religious accommodation is purely vindictive and punitive,” the group’s general counsel, Michael Berry, said in a statement to the media.

The Navy did not comment on the matter. “We are aware of the injunction and are reviewing it,” Pentagon spokesperson John Kirby said.

President Joe Biden’s wider vaccine mandate for companies with more than 100 employees is currently facing a challenge in the Supreme Court, which is scheduled to hold a special hearing on the matter on Friday.

 

[Apollonian]

Here's some info on the "mass formation psychosis" deliberately induced by gov., Jews-media, Big-Pharma, et al., regarding mania for the poison vaxxes

 

[Apollonian]

BOMBSHELL: Biological Study PROVES Pfizer mRNA Vaccine Permanently Alters Human DNA​

a day ago

Link: https://en-volve.com/2022/02/26/bom...er-mrna-vaccine-permanently-alters-human-dna/

ShareShare on Pinterest Share on FacebookShare on Twitter

Share this story:
175Shares
Our trustworthy “health experts and fact checkers” have been warning us for over a year that mRNA vaccines, such as those made by Pfizer and Moderna, do not incorporate into human cellular DNA.
However, a recent study published in Current Issues in Molecular Biology revealed that health experts and fact checkers were inaccurate.
mRNA vaccinations DO incorporate themselves into human cellular DNA, according to lab experiments. Vaccines, in essence, alter your DNA for the rest of your life.

What that signifies is that lab experiments have shown that mRNA vaccines DO integrate into human cellular DNA. This means that even a single dose of Pfizer vaccine permanently alters the DNA of afflicted cells.

The mainstream media and fact checkers have made it their mission to persuade us the exact opposite:

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov reports:
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?

Simplified​

As I explained in response to a questioner:

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big implication for our public health.
EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?